Sion levels soon after reperfusion were calculated as the percentage from the basal levels just before graft harvesting.2004 Lippincott Williams WilkinsSurgical Procedure and Experimental DesignThe experiment was performed in 2 groups of rats: manage group (n 44) and FK 409 therapy group (n 40). A rat model of nonarterialized orthotopic liver transplantation with no veno-CD115/M-CSF R Proteins Storage & Stability venous bypass was applied as described previously.1 The lobe ligation technique was employed to lessen the graft size around the backtable. The median lobe with the liver was selected to be the graft along with the median ratio with the graft weight to recipient liver weight (graft weight ratio) was 39 (range 36 46). The graft was stored in cold saline having a target cold ischemic time of 80 minutes. Inside the FK 409 treatment group, two mg/kg FK 409 (type gift from Fujisawa Pharmaceutical Co., Ltd., Japan) in 1 mL of saline was given intravenously 30 minutes prior to graft harvesting within the donors, and 1 mg/kg FK 409 in 1 mL of saline was given instantly right after liver transplantation inside the recipients. Exactly the same amount of saline was offered in the manage group at the very same time points.Survival StudyTen rats in the FK group and 14 rats inside the handle group had been utilized for survival study. Rats that had lived for far more than 7 days right after transplantation were regarded survivors.Hemodynamic StudySix rats in each and every group had been employed for hemodynamic study. After induction of anesthesia, the right jugular vein on the recipient was cannulated together with the tip of a catheter positioned at the entrance on the ideal atrium for monitoring on the central venous pressure. The left femoral artery and ileocolic vein had been cannulated by a catheter for measurement on the mean arterial Galanin Proteins Formulation pressure and portal pressure, respectively. All catheters had been connected through the stress transducers (MLT1050 Blood Stress, PowerLab Technique, ADInstruments Pty Ltd., Australia) and Quad Bridge Amp (ML118 Quad Bridge Amp, PowerLab Technique, ADInstruments Pty Ltd.) to aAnnals of Surgery Volume 240, Quantity 1, JulyFK409 Attenuates Small Liver Graft InjuryTABLE 1. Probes and Primer Pairs for Intragraft Gene Detection Making use of Quantitative Reverse-Transcription Polymerase Chain Reaction Gene Egr-1 ET-1 ETA HO-1 A20 CXCR2 IP-10 CXCR3 MIP-2 Probe (FAM) TGTGACACACCTTGCCGATGG AGACCCCGCAGGTCCAA CCCTGCCTAGCAATGGCTCAATGC TGCCCCGCTCTACTTCCCTGAGG TTTAAAACCATGCACCGATACACGCTGG ACCTGCTCTGTCACCG ACGAGGCAGAGAAC TTGCCTAGCAGCCC CCCAGACAGAAGTCA Primer pairs Sense: AGTTTCACGTCTTGGTGCCTTT Anti-sense: CCCTCACGATTGCACATGTC Sense: TGATGTCCAGGTGGCAGAAGT Anti-sense: TGCTCCTGCTCCTCCTTGATGGACAAG Sense: CCTTCGACCCCCTAATTTG Anti-sense: CCACCATTCCCACGATGAA Sense: CGAAACAAGCAGAACCCAGTCT Anti-sense: AGCCCTTCGGTGCAGCT Sense: AACCTACCAATGGGATCATCTATCA Anti-sense: GGCAAAACTGGCATGTTCTGA Sense: TGCTGGTCATCTTGTACAATCGA Anti-sense: GGCCAGGTTCAGCAGGTAGAC Sense: GAAGCACCATGAACCCAAGTG Anti-sense: GCGAGAGGGATCCCTTGAGT Sense: CAGTCCTCTACAGCCTCCTCTTTT Anti-sense: TGCGCTGGCTCAGTAGCA Sense: AGAACATCCAGAGCTTGAGTGTGA Anti-sense: TTTTGACCGCCCTTGAGAGTIntragraft Protein Levels of Egr-1, A20, HO-1, and MIP-2 by Western BlotNuclear protein was extracted as described previously for detection of Egr-1 expression. Total protein was employed for A20, HO-1 and MIP-2 detection. The protein samples have been separated in ten sodium dodecyl sulfate-polyacrylamide gel and electrophoretically transferred to polyvinylidene fluoride membrane (Amersham, Buckinghamshire, UK) using the BioRad electrotransfer program (Bio-Rad Laboratories, Mun.